[Taxacom] orangutan theory under scrutiny

[John Grehan]

In response to Stephen Thorpe,

Reference to overall percentage of DNA similarity fails to demonstrate
whether the similarities are derived or primitive retentions.

Convergence is often raised as an objections, but it is just a
rhetorical objection and it is one that could apply to DNA bases as much
as morphology.

As for the probability of DNA being wrong - its 100% if the morphology
is right. With the orangutan-human case evolutionists are confronted
with a situation where there is incongruence between patterns of DNA
base similarity and morphological similarity The morphological argument
is that each character state included in the analysis is limited to
those that are derived (either unique to the in-group, or sufficiently
rare in the outgroup to be predicted to be independently derived for the
in-group), and to top it off, the morphological comparison includes a
broad outgroup coverage, in this case comprising lesser apes and Old
World monkeys. In theory that includes ALL species in both group. In
practice it is often less, but to be valid the derived state should
apply in comparison to all members of the outgroup. We argue that
individual restriction of characters to those with derived character
states prior to the analysis is only possible in the morphological
method. But that is just an opinion. At present there is no recipe by
which to decide between morphology and molecules when they contradict
each other.

As for 'few', the number is 28 at present for humans and orangutans. It
may be as high as 45, but the additional number have require further
investigation to determine their validity. For example, humans and
orangutans may have the greatest right-left brain asymmetry, but the
number of samples and measurement accuracies involved are too small. 

I suggest you read the article so as to see our arguments on molecules.

John Grehan

-----Original Message-----
From: taxacom-bounces at mailman.nhm.ku.edu
[mailto:taxacom-bounces at mailman.nhm.ku.edu] On Behalf Of Stephen Thorpe
Sent: Monday, September 07, 2009 12:21 AM
To: taxacom at mailman.nhm.ku.edu
Subject: [Taxacom] orangutan theory under scrutiny

Just going by the Calgary Herald article:

>Humans and chimps share 98 per cent of the same DNA, compared to 96 per

>cent with orangutans

This fact requires an explanation. Admittedly, it would be more
convincing if the actual sequences were 98% identical, but I think it
just means the proportions of bases, doesn't it? In other words, if Homo
and Pan both had the sequence
"AGGTCTTAAAACCCCTTTTCAGTCAGTCAGTCCCCAAAAAGTC", and Pongo didn't, it
would be highly improbable that this was due to chance! Still, there
must be some sort of estimate of the probability of two genomes being
98% the same in the weaker sense by chance? I think this probability is
pretty crucial to know, at least approximately? Like the probability of
two people having the same fingerprints...

> DNA is not the only indicator for evolution and that orangutans share 
> many more biological features with humans than chimps

the features mentioned are a mixture of morphological and behavioural.
Presumably, it is harder to quantify the likelihood of chance being
responsible for these shared features, but convergence/homoplasy would
seem to be a real possibility here. Given enough time, it would not be
at all surprising if other great apes evolved in parallel fashion to
Homo - they are kind of only one step away...

So, I would like to hear John Grehan's response to these specific
points, i.e, what is the probablity of the DNA evidence being wrong
(assuming it was done right), and why are a few
morphological/behavioural similarities less likely to be due to chance,
convergence, and/or homoplasy?

_______________________________________________

Taxacom Mailing List
Taxacom at mailman.nhm.ku.edu
http://mailman.nhm.ku.edu/mailman/listinfo/taxacom

The Taxacom archive going back to 1992 may be searched with either of
these methods:

(1) http://taxacom.markmail.org

Or (2) a Google search specified as:
site:mailman.nhm.ku.edu/pipermail/taxacom  your search terms here