[Taxacom] orangutan theory under scrutiny

[Stephen Thorpe]

Just going by the Calgary Herald article:

>Humans and chimps share 98 per cent of the same DNA, compared to 96 per cent with orangutans

This fact requires an explanation. Admittedly, it would be more convincing if the actual sequences were 98% identical, but I think it just means the proportions of bases, doesn't it? In other words, if Homo and Pan both had the sequence "AGGTCTTAAAACCCCTTTTCAGTCAGTCAGTCCCCAAAAAGTC", and Pongo didn't, it would be highly improbable that this was due to chance! Still, there must be some sort of estimate of the probability of two genomes being 98% the same in the weaker sense by chance? I think this probability is pretty crucial to know, at least approximately? Like the probability of two people having the same fingerprints...

> DNA is not the only indicator for evolution and that orangutans share many more biological features with humans than chimps

the features mentioned are a mixture of morphological and behavioural. Presumably, it is harder to quantify the likelihood of chance being responsible for these shared features, but convergence/homoplasy would seem to be a real possibility here. Given enough time, it would not be at all surprising if other great apes evolved in parallel fashion to Homo - they are kind of only one step away...

So, I would like to hear John Grehan's response to these specific points, i.e, what is the probablity of the DNA evidence being wrong (assuming it was done right), and why are a few morphological/behavioural similarities less likely to be due to chance, convergence, and/or homoplasy?